MINTbase v2.0: a framework for the interactive exploration of mitochondrial and nuclear tRNA fragments

Found 28,824 tRNA fragment(s) corresponding to 125,285 genomic location(s)

MINTbase Unique ID
(sequence derived)
Fragment sequence
Fragment Length
5'-half
5'-tRF
i-tRF
3'-tRF
3'-half
Total number of genomic instances
in known tRNA space
Exclusively within tRNA genes?
Expressed (# of datasets)?
Maximum RPM
View tRNA alignment
tRF-24-BBKN8LEZ22 AAAAACCATTTCATAACTTTGTCA 24 AspGTC (mt) 1 no yes (1) 1.101 View fragment on tRNA
tRF-17-BBSQ6KJ AAAAAGTCATGGAGGCC 17 SerTGA (mt-la), SerTGA (mt) 2 yes yes (294) 6.682 View fragment on tRNA
tRF-20-BBSQ6KK4 AAAAAGTCATGGAGGCCATG 20 SerTGA (mt-la), SerTGA (mt) 2 yes yes (2) 1.263 View fragment on tRNA
tRF-22-BBSQ6KK44 AAAAAGTCATGGAGGCCATGGG 22 SerTGA (mt-la), SerTGA (mt) 2 yes yes (19) 2.556 View fragment on tRNA
tRF-23-BBSQ6KK4DY AAAAAGTCATGGAGGCCATGGGG 23 SerTGA (mt-la), SerTGA (mt) 2 yes yes (1) 1.087 View fragment on tRNA
tRF-25-BBSQ6KK4RN AAAAAGTCATGGAGGCCATGGGGTT 25 SerTGA (mt-la), SerTGA (mt) 2 yes yes (1) 1.218 View fragment on tRNA
tRF-27-BBSQ6KK4RN4 AAAAAGTCATGGAGGCCATGGGGTTGG 27 SerTGA (mt-la), SerTGA (mt) 2 yes yes (2) 1.740 View fragment on tRNA
tRF-18-BBZY7FW AAAAATTTTGGTGCAACT 18 LeuTAG (mt) 1 no yes (2) 1.817 View fragment on tRNA
tRF-19-BBZY7FE5 AAAAATTTTGGTGCAACTC 19 LeuTAG (mt) 1 no yes (11) 5.630 View fragment on tRNA
tRF-20-BBZY7FER AAAAATTTTGGTGCAACTCC 20 LeuTAG (mt) 1 no yes (4) 1.822 View fragment on tRNA

We gratefully acknowledge support of this work by the William M. Keck Foundation.

Please email us for questions and/or suggestions.