MINTbase v2.0: a framework for the interactive exploration of mitochondrial and nuclear tRNA fragments

Found 26,744 tRNA fragment(s) corresponding to 117,371 genomic location(s)



MINTbase Unique ID
(sequence derived)
Fragment sequence Fragment Length 5'-half5'-tRFi-tRF3'-tRF3'-halfTotal number of genomic instances in known tRNA space
Exclusively within tRNA genes?
Expressed (# of datasets)?
Maximum RPM
View tRNA alignment
tRF-24-BBKN8LEZ22AAAAACCATTTCATAACTTTGTCA24AspGTC (mt)1noyes (1)1.101View fragment on tRNA
tRF-17-BBSQ6KJAAAAAGTCATGGAGGCC17SerTGA (mt-la), SerTGA (mt)2yesyes (294)6.682View fragment on tRNA
tRF-20-BBSQ6KK4AAAAAGTCATGGAGGCCATG20SerTGA (mt-la), SerTGA (mt)2yesyes (2)1.263View fragment on tRNA
tRF-22-BBSQ6KK44AAAAAGTCATGGAGGCCATGGG22SerTGA (mt-la), SerTGA (mt)2yesyes (19)2.556View fragment on tRNA
tRF-23-BBSQ6KK4DYAAAAAGTCATGGAGGCCATGGGG23SerTGA (mt-la), SerTGA (mt)2yesyes (1)1.087View fragment on tRNA
tRF-25-BBSQ6KK4RNAAAAAGTCATGGAGGCCATGGGGTT25SerTGA (mt-la), SerTGA (mt)2yesyes (1)1.218View fragment on tRNA
tRF-27-BBSQ6KK4RN4AAAAAGTCATGGAGGCCATGGGGTTGG27SerTGA (mt-la), SerTGA (mt)2yesyes (1)1.004View fragment on tRNA
tRF-18-BBZY7FWAAAAATTTTGGTGCAACT18LeuTAG (mt)1noyes (2)1.817View fragment on tRNA
tRF-19-BBZY7FE5AAAAATTTTGGTGCAACTC19LeuTAG (mt)1noyes (10)5.630View fragment on tRNA
tRF-20-BBZY7FERAAAAATTTTGGTGCAACTCC20LeuTAG (mt)1noyes (4)1.822View fragment on tRNA

We gratefully acknowledge support of this work by the William M. Keck Foundation.
Please email us for questions and/or suggestions.