Off-Spotter

returned 2350 results

for hg19, NGG, seed --------------------, 5 maximum mismatches, and annotations on

TIP! You can dynamically sort by one or multiple columns (hold shift). E.g. to order by strand and start position, hold down shift and then click first the strand and then the start column.
TIP! You can hide columns using the Hide Columns menu.

Number of results per 20mer

# of occurences20mer# of results per # of mismatches
2350CATCATCAAAGACCAAAAGT
022
135
260
352
4251
51930

Results per 20mer

2350 results for CATCATCAAAGACCAAAAGT

Please wait, the table is being sorted...
ChromStrandStartEndGiven queryActual genomic hitNumber of mismatches Pre-mRNA (Unspliced)mRNA (5UTR)mRNA (CDS)mRNA (3UTR)lincRNA (Unspliced)lincRNA (Spliced) GC content External links
3+2432193524321957CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0
(THRB - thyroid hormone receptor, beta)
-----35.0%UCSC Genome Browser
3+3897472238974744CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0
(SCN11A - sodium channel, voltage-gated, type XI, alpha subunit)
-----35.0%UCSC Genome Browser
3+163147891163147913CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
6+130797657130797679CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
7+3234836832348390CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
7+3250501932505041CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
11+2981701529817037CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0----
(CTD-3138F19.1)
-35.0%UCSC Genome Browser
11+127233928127233950CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
12+8426574384265765CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
12+105640587105640609CATCATCAAAGACCAAAAGTCATCATCAAAGACCAAAAGT-AGG0------35.0%UCSC Genome Browser
Go to the top of this table Go to the top of the page
We gratefully acknowledge support of this work by the William M. Keck Foundation.
Please email us for questions and/or suggestions.