Banner


Back to Off-Spotter home

Off-Spotter returned 219 results for 1 20mers in forward strand and 0 in the reverse
for hg19, NGG, seed ---------------xxxxx, 5 maximum mismatches, and annotations on

TIP! You can dynamically sort by one or multiple columns (hold shift). E.g. to order by strand and start position, hold down shift and then click first the strand column and then the start column.
TIP! You can hide columns using the Hide Columns menu.

20mers found

# of occurencesStrand20merReverse complement ofStarting position on input# of results per mismatch
219+CAGAATTGATACTGACTGTA1
01
10
21
33
430
5184
20mer coordinates on input
  1 CAGAATTGATACTGACTGTATGG                             23
  CAGAATTGATACTGACTGTA⇒




Results per 20mer

219 results for CAGAATTGATACTGACTGTA
Please wait, the table is being sorted...
ChromStrandStartEndGiven queryActual genomic hit
Number of
mismatches
Pre-mRNA (Unspliced)mRNA (5UTR)mRNA (CDS)mRNA (3UTR)lincRNA (Unspliced)lincRNA (Spliced) GC content External links
3-4641494046414962CAGAATTGATACTGACTGTACAGAATTGATACTGACTGTA-TGG0
ENSG00000160791:
(CCR5 - chemokine (C-C motif) receptor 5 (gene/pseudogene))
ENST00000343801
ENST00000292303
ENST00000445772
-
ENSG00000160791:
(CCR5 - chemokine (C-C motif) receptor 5 (gene/pseudogene))
ENST00000292303
ENST00000343801
ENST00000445772
---35.0%UCSC Genome Browser
13+5426312054263142CAGAATTGATACTGACTGTAtAGAATTGATACTGtCTGTA-TGG2------30.0%UCSC Genome Browser
8-139024559139024581CAGAATTGATACTGACTGTAtAtAtTTGATACTGACTGTA-AGG3----
ENSG00000253288:
(RP11-238K6.1)
ENST00000518973
-25.0%UCSC Genome Browser
2+170946127170946149CAGAATTGATACTGACTGTAaAGAATTGtTACaGACTGTA-GGG3------30.0%UCSC Genome Browser
13+8879360688793628CAGAATTGATACTGACTGTACAtAATTGATgCTcACTGTA-TGG3------35.0%UCSC Genome Browser
8-4237911342379135CAGAATTGATACTGACTGTAaAagATTGATAaTGACTGTA-TGG4
ENSG00000168575:
(SLC20A2 - solute carrier family 20 (phosphate transporter), member 2)
ENST00000342228
ENST00000520179
-----25.0%UCSC Genome Browser
3-191315498191315520CAGAATTGATACTGACTGTAgAtAAaaGATACTGACTGTA-TGG4------30.0%UCSC Genome Browser
9-3605034236050364CAGAATTGATACTGACTGTAaAGAATTaAgAaTGACTGTA-AGG4
ENSG00000122707:
(RECK - reversion-inducing-cysteine-rich protein with kazal motifs)
ENST00000377966
-----25.0%UCSC Genome Browser
14+5581612855816150CAGAATTGATACTGACTGTAtAGAATTaATAagGACTGTA-GGG4
ENSG00000178974:
(FBXO34 - F-box protein 34)
ENST00000313833
ENST00000440021
-----25.0%UCSC Genome Browser
1+7330477273304794CAGAATTGATACTGACTGTAgAGAATTGcTtCTcACTGTA-TGG4----
ENSG00000225087:
(RP4-660H19.1)
ENST00000445976
-40.0%UCSC Genome Browser

Go to the top of this table
Go to the top of the page




We gratefully acknowledge support of this work by the William M. Keck Foundation.
Please email us for questions and/or suggestions.