MINTbase v2.0: a database for the interactive exploration of mitochondrial and nuclear tRNA fragments (tRFs)

04/04/2019 stats: 28,824 expressed tRFs | 12,023 datasets | 125,285 genomic instances

The Mitochondrial and Nuclear tRNA fragment database (MINTbase) is a repository of tRNA fragments (tRFs). You can view tRFs form multiple viewpoints (vistas) on the left and subselect the tRFs of interest using the filters on the right!

Use of the data contained in this database is limited to research-oriented, non-profit activities only. If you are interested in for-profit use, please contact us.

Genomic loci
RNA molecule
tRNA alignment
Expression
Summary

Genome:

Minimum RPM value: ^{Fragment must have an RPM value of at least the selected value in at least one submitted dataset.
Click here for a list of the pubmed ids of the papers currently in MINTbase.}

Type(s): ^{Select one or multiple tRF types by holding shift or control.

tRF types: Letting XYZ be the anticodon and abXYZcd indicate the immediate vicinity of it, then:
5'-half: any fragment that begins at the 5' end "+1 position" or at the "-1" position of a tRNA and ends in one of 'a,' 'b,' 'X' or 'Y.'
3'-half: any fragment that begins at one of 'b,' 'X,' 'Y' or 'Z' and ends in either the first 'C,' the second 'C,' or the 'A' of the non-templated 'CCA' addition.
5'-tRF: any fragment that begins at the 5' end "+1 position" of the tRNA or at the "-1" position and ends in a position other than 'a,' 'b,' 'X,' or 'Y.' In other words, a 5'-tRF ends either before 'a' or after 'Y' (including potentially positions to the right of d).
3'-tRF: any fragment that begins at a position other than 'b,' 'X,' 'Y' or 'Z' and ends in either the first 'C,' the second 'C,' or the 'A' of the non-templated 'CCA' addition. In other words, a 3'-tRF begins either after 'Z' or before 'b' (including potentially positions to the left of a).
i-tRF: any fragment that both does not begin at the 5' end "+1 position" or the "-1" position, and does not end at the first 'C,' the second 'C,' or the 'A' of the non-templated 'CCA' addition. For more information on i-tRFs, see here.}

Anticodon(s): ^{The anticodons of tRNA genes harbored in nuclear chromosomes are flagged as "n" and those in the mitochondrial chromosome as "mt". The exact tRNA-lookalikes of mt anticodons are flagged as "mt-la". For more on tRNA-lookalikes, see here.}

→

Search by tissue keyword: ^{Enter a full length keyword, or, a partial string to get suggestions based on what is already included in MINTbase. Select among the shown suggestions to view the tRFs that correspond to it.
Examples:
BRCA
liv
breast
TCGA
Prostate Adenocarcinoma
Some of the suggestions are meant to accommodate misspellings. E.g. you can type "lver" instead of "liver" and you will still be prompted with "liver" as one of the tissues for which tRFs are available.}

Search by tRNA name: ^{Enter a MINTbase tRNA ID, a gtRNAdb ID, a HGNC symbol, or a legacy ID.
View correspondence table.

Examples:
trna35_GlyGCC_1_+_161413094_161413164
tRNA-Gly-CCC-6-1}

Search by tRF sequence: ^{Enter a tRNA fragment sequence.
Examples:
GCATTGGTGGTTCAGTGGTAGAATTCTCGC
TGCCGTGATCGTATAGTGGTTAGT}

Search by tRF label: ^{ID that depends solely on the tRF's genomic sequence and, hence, transcends assemblies and species. Find out more.

OR
Assembly specific ID that consists of the tRNA ID, the start and end position of the tRF relative to the mature tRNA and the tRF's length.

OR
Examples:
tRF-30-P4R8YP9LON4V
trna35_GlyGCC_1_+_161413094_161413164@1.29.29}

Chrom:

Strand:

Start-End: - ^{Returns fragments that overlap (at least one nucleotide in common) with the all-inclusive range inserted. This filter is only applicable in genomic loci and tRNA alignment vistas.
Examples: 27870686 and 27870756.}