MINTbase v2.0: a database for the interactive exploration of mitochondrial and nuclear tRNA fragments (tRFs)
Found 28,824 tRNA fragment(s) corresponding to 125,285 genomic location(s)
License Plate (sequence derived) |
Fragment sequence |
Fragment Length |
5'-half |
5'-tRF |
i-tRF |
3'-tRF |
3'-half |
Total number of genomic instances in known tRNA space |
Exclusively within tRNA genes? |
Expressed (# of datasets)? |
Maximum RPM |
View tRNA alignment |
|---|---|---|---|---|---|---|---|---|---|---|---|---|
| tRF-24-BBKN8LEZ22 | AAAAACCATTTCATAACTTTGTCA | 24 | AspGTC (mt) | 1 | no | yes (1) | 1.101 |  |
||||
| tRF-17-BBSQ6KJ | AAAAAGTCATGGAGGCC | 17 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (294) | 6.682 | |
||||
| tRF-20-BBSQ6KK4 | AAAAAGTCATGGAGGCCATG | 20 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (2) | 1.263 | |
||||
| tRF-22-BBSQ6KK44 | AAAAAGTCATGGAGGCCATGGG | 22 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (19) | 2.556 | |
||||
| tRF-23-BBSQ6KK4DY | AAAAAGTCATGGAGGCCATGGGG | 23 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (1) | 1.087 | |
||||
| tRF-25-BBSQ6KK4RN | AAAAAGTCATGGAGGCCATGGGGTT | 25 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (1) | 1.218 | |
||||
| tRF-27-BBSQ6KK4RN4 | AAAAAGTCATGGAGGCCATGGGGTTGG | 27 | SerTGA (mt-la), SerTGA (mt) | 2 | yes | yes (2) | 1.740 | |
||||
| tRF-18-BBZY7FW | AAAAATTTTGGTGCAACT | 18 | LeuTAG (mt) | 1 | no | yes (2) | 1.817 | |
||||
| tRF-19-BBZY7FE5 | AAAAATTTTGGTGCAACTC | 19 | LeuTAG (mt) | 1 | no | yes (11) | 5.630 | |
||||
| tRF-20-BBZY7FER | AAAAATTTTGGTGCAACTCC | 20 | LeuTAG (mt) | 1 | no | yes (4) | 1.822 | |
We gratefully acknowledge support of this work by the William M. Keck Foundation.
Please email us for questions and/or suggestions.